rnd-5_family-4087

Seqidrnd-5_family-4087#DNA/Merlin
Seqnamernd-5_family-4087
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameEsox lucius
SeqTAGTGATTATTAATGTATGATAATTCATCATTTTACTTAAGGGGNCACAAAATAATTAACTAATGGTGAAGTATCAGTTATTAANGGTTTATAGCTACCCATGTGTCATTAGTTAGTGATTGTTAATGTAGGATAATTCATCACTTTACTTAAGGGGACACAAAATAATTANCTAATAGTGAGGTATCCTTTATTAATGCTTTATTCCGGCTCAATGGTTACTCAGCGGGCCAAAAGAGTATGAACTAATGATTTGGTGTTAGAATACTAGTGATAGCACATAATCCTCCCTTCAAGAATGACAGGATTAACTAAGTGTAGGCTATAAAGACAATTTGTAAAACAACCACTCTGGAAACATGGACATCATGAAGGAAGAGATGAGTAATGTATTTTCAGTGGAAGTGTAAACAGGCAAGTCTTATGCAAAAATAAACAGTCACATTAATCAGTCAATCAAATGTAATTTTGTCAAGCCCTTTTTACATCAGACATTTCACAAAGTTCTTATACAGCAGTAATGTTGTACTTATGTGTAAAACACCTTCATGTTCAGCTAGTGTAGTAAAATCTGGTAAAAGGATTAGACAATTGCAAATTACCTTAATGTTAACACGAATATAATATGGCTGAGCAAGCTAGCAAAGTGCTAACCGAAACTAACAAACACTTGACTGGAGCTAGCATACAGCTAACTGGAGCCAGCTAACAGGAACTAGCTAATCGCTAACCCTTACAGTGCAACAACTGCAAAGTTCCTAAACAATACAGTTACAAAATTCAATNATATTAATCCTAGGGATATTGTCAGGAGTGTTGTTT