rnd-4_family-584

Seqidrnd-4_family-584#DNA/Merlin
Seqnamernd-4_family-584
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameEsox lucius
SeqAGGTAACACTTTATTTTGCTCTACAGATTATCTACAGACTATCAGTAACATTTNAANTAACTATCTACTAACCCTAACCTTTCCTTATCCTAACCCTAACCTTTATTCACCCTAACCTTAACCCTTACCCTAAACCTTATTCTAAACCTACCTAACCCTAACCTTAGCAAGCAGTTGCTTATCAACGATAGTTTGTTTAAAGTTTGTTGAAATTTGTTGATAGTATTACTATCTATAGAGCATCTACAGATGGACATTGGGACTCTCAAAATAAAGTGTAACCAA