rnd-4_family-421

Seqidrnd-4_family-421#DNA/Merlin
Seqnamernd-4_family-421
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameTrachurus trachurus
SeqGTAACACTTTACAATAAGGGTCCCTTAATTAACGTTAGTTAGTACATTATTAAGCATTAATTAACTGTTTACAGATATATTAACAATCATTATTATGTATTACTTAGGATTAGGAAACACATTAATTAATGTAGCCTATTAGTAAGCAGTTAAAGCAGAAGTAAGCGGNATGTTTGTGTTAATATAAGTCTTAAATAGTTATATCTTCCGACAGCAATCACTTACATAGAGTGTTTGGTCCGAAACACGGGTCTGTCAGTCACTCTGCTCTGCTCTGAGCCGAGGAGAAAACTTTCCTCGTATCCTACAACTTTTATCCAATGAGGAGAGAGAACGGCATGAAGGGCTGTGTGTGCAGCCAAGGGACGCGCGTGAATGTGGTGACGTAGGGACGAGGACTGTTATGGTGCGTTCAAGGAAACTCGTACTCGTGTTTTTCCGACCTGTGAAGTCGTACCAGTTCGATCTGGTACGAGTTCACGGGTCGGAAGTTACGAGTGGCCGTTATAGTGACTTTCACCGGTAAAACAGGTCGGAAAAACACGAGTGGGTTGCCTGGAACGCTACAAAGTCGTAAGTTGTGACTTGAAGCTGTAATTTACGGTTTCAAAAGCCTGCCTGGAACGCAGCATTAGCCAAAACGACCGGATCGCTTACTTCTGCTTTAATTAATGTTTACTACTCAAAGTTAGTTAAGTAATAATAAAAGTTGAATAATGTAATTAGTTATCATTATGTATGCATTACTCAGCATTAATTAACACATTAGTTTATATATTAATGCTTAATAATGTACTAACTAACGTTAATTAAGGGACCCTTATTGTAAAGTGTT