rnd-1_family-293

Seqidrnd-1_family-293#DNA/Merlin
Seqnamernd-1_family-293
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameTrachurus trachurus
SeqATAGGTATTCATAACAGCTGTCATAAACATCAATGAATACTTATGACAGCTGTCGTTAAGTGTCATTCGGTAAGTTATGTCACTTTTGATGCAAAGTTGACATTGTTTGAGATGTTTTTGTTCTGACAACTTGACATAAAGACAATTTAAACTGTCATAGCAGACCTAATTGCCAAACTTTAAAAATTATGTCAAGTTNTCATAACAAGGACATCTCAAACAATGTCAACTTTGCATCAAAAGTGACATAACTTACCGAATGACACTTAACGACAGCTGTCATAAGTATTCATTGATGTTTATGACAGCTGTTATGTCATGGTTATGACAGTGTTATGTCANTCTTATGAATACCTATTCAAGTAAAGTGTTACC