rnd-5_family-1682

Seqidrnd-5_family-1682#DNA/Merlin
Seqnamernd-5_family-1682
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameSiniperca chuatsi
SeqGTTAGCGTTTTATCTTGATACCCAAAGTGCTTCACAGTGAAGGGGGGAAACTCACCTCAACCACCACCAATGTGGTTAGGTTAGCTAACGTTACTTTAGCAACAAGTAAAGCTATCTGTCCATCAGGAAACTCCATAAATCACCTTGGTACTGTACTCTGTCGTCAAACTGGCCTTATAACATTGNTGACATCTTTATGACAAGTTCAAATGGTTCCACTTTACTTGAGGTCAAGGGAATTATTCATGACACCGTTATAAAAGCATTTGACAGTGTAATAAAACTTANTGACATCTTTATGACAAGTTCAAATGGTTCCACTTTACTTGAGGTCAAGGGAATTATTCATGACACAATTATAATGGTCTCATGACAGTCGTTGTCAAAACCAAGCACATATGACAGTATAATGTAATGTTAACACATAAAGCTAAATAGTTTCTTTAAGTTTGATAATTAGGCCTGCTATGGCATGTTTATGACAGGTTATGTTTTCTTGGTTAATGTCAAGTTGTCATAACAAAGACATCTCAAACAATGTCAACTTTGCATTAAAAGTGACATAATTGACCGAATGACACTTAATGACAACAGTCATAAACCTTCATAAAGACTCCTTCATGTTCATGACAGGTGTCATGTCATGGTTATGACGGTGTCATGTCAGTCTTATGCACACCCCTTCAAATAAAGTGTT