rnd-6_family-29221

Seqidrnd-6_family-29221#DNA/Merlin
Seqnamernd-6_family-29221
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NamePlaniliza haematocheilus
SeqTAACACTTTATATTAGGGAACACCTATTCACCATTAACTAGTTGCTTATTAGCATGCAAATTAATAACATACTGGCTCTTAAATTGTCATTATTAAGAACTTATTAATGCCTTATTCTGCATGGCCTTATTATACAACCAGTAAGCCATTAACTAAGAGTTTTCCCTCAATAAGCTCAGAATTATTGTTTATTAGTAGTAAGTTTTGGCAGATTTTGGTTAAAGAATCCGACAGATTTTCAACAAGAGTACCTGTACCATCATACAGTATGACCTGCTTATACATTTGACACCATATTGTTTGACATGTTTATATACACCAATATTTGTCAGTGTTTGAATTTTCAGGCAGACCCCATTACCTGGAAGTTAAACTACACAGCAAGTTCACACAGGTTTGTTGTCAGCCTTGGGAAAACCTGAACCAGTGGTTTAATAAATGAGGTATTTGTTCTTGTGCCGTCTTTGTTATTCTACCACTGAATGAGAGGGAACCTATAGATTGATCCATTTTTTTGAAAGGTGCAACCCATCACTTGTTCATTGCAGTAGTTGCTATAATATATTAACTAAGTGTGAAAAGGAGGCAACTTTAGATTAGAGAACACGTGTTGGTTAATAAGTGTTCAACTATTAGTGAATTAGTAATGATCAAGATGTCACTTTAGTATGGGGAACATATTCTAAGTAGCAAAGACTTAATTTAGAGTTATTTGGACACTATTAACACTTGTAGTTTTGTGTTTTGTTAACAGACCATATTCATTAAGTGTTATTAAGGGAGAATAACTATTCTTGTGGTACTACCACCTTATAAAGTCCATACTAAGCAAAGCATATTGAGATCGNAATTCATGTGCAACAACTTCTTAACTTACTACTAATAAACAATAATTCTGAGGTTATTGAGGGAAAACTCTTAGTTAATGGCTTACTGGTTGTATAATAAGGCCATGCAGAATAAGGCATTAATAAGTTCTTAATAATGACTATTTAAGAGCCAATATGTTACTAATTTGCATGCTAATAAGCAACTAGTTAATGGTGAATAGGTGTTCCCTAATATAAAGTGTTACC