rnd-6_family-5185

Seqidrnd-6_family-5185#DNA/Merlin
Seqnamernd-6_family-5185
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameCoilia nasus
SeqGTAACACTTTATTTGAAGGTGTCTACATAAGAGTGACATGAGCCTTTATGAACATGACATGACACATCATGAACATTAATGACACTTACATTCATGTTTATGACTGTTGCNATTAAGTGTCATTTGTTTTTTGCAATGTTAAGTTGATATTTTTGGGATGCAGACATTGCAAAAACCAAATGACACTTAATGACAACAGTCATAAACATGAATGAAGTGTCATTAATGTTCATGATATGTGTCATGTCATGTTTATAANGGGCTCATGTCACCCTTACGTAGACACCTTCAAATAAAGTGTTA