rnd-6_family-5230

Seqidrnd-6_family-5230#DNA/Merlin
Seqnamernd-6_family-5230
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameCoilia nasus
SeqGTAAATAATAATACAATTAATCATCATTTTAGCGCAAATCTAAAAGTGCAACATTGTTATGGCNGGACATTATCTGGCTGAGTGCTTCGATTGGTCTGGAACTCTCAGGTGCTGAGTTCATGCAATGTCAAGTTGTCATGACAACATCATAAACAGGTTGCATTTTGTTGGCTAATGTCAAGTTGTCATGACAAAGACATTGTCTGGCAATGTCATCTTGGTTAATGTCAAGTTGTCATTATGAGGACACCCAAAACAATGTCAACTT