rnd-6_family-27171

Seqidrnd-6_family-27171#DNA/Merlin
Seqnamernd-6_family-27171
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameLateolabrax maculatus
SeqTGACAAGTCCAAATTGTACCACTGTAGTTGAGGTCAAGGAAAATATTCANGACACAATTATAATGGTCTCATGACAGCTAATGTCAAAACCAACCACATATGACAGTTTAATGTAATGTTAACACATAAAGCTAAATAGTTTCTTTAAGTTTNACAATCAGGCCTGCTATGNCATGTTTACGACAGGTTATGTTGTCTTGGTTAACGTCAAGTTGTCATAACAAAGACATCTCAAACAATGTCAACTTTGCATTAAAAATGACATAATTGACCGAATGACACTTAATGACAACANTCATAAACATTCATAAAGACTCNTGTCATGNTCATGACGGTGTCAGTCTTATGCACACCCCTTCAAATAAAGTGT