rnd-6_family-2896

Seqidrnd-6_family-2896#DNA/Merlin
Seqnamernd-6_family-2896
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameSparus aurata
SeqGGTTCTAATTGTATATGACAGTTACAAACTCATTTGGCAGTGTAGTTACACTTAATGACATCATAATGAAAGGCACAATGTTTAGGACACAATCATAATGGTCTTGTGACAGCTAATGTCAAAACGAACCACATATGACAGTTTAATGTNATGTTATCATATAAAGCTAAATAGTTTTNTAAAGTTTGACAGTGAGGCCTGCTGTGNCATGTTTATGACAGGTTATGTTGTCTTGGTTNACGTCAAGTTGTCATAACAAAGACATCTCAAACAATGTCAACTTTGCATCAAAGGTGACATAATTNACCGAATGACACTTAACGACAACNGTCATAAGCATTCATTAACGTTCATGACAGGTGTCATGTCACGGTTATGACAGTGTCATGTCAGTCTTATGCACACCCCTTCAAATAAAGTGTTAC