rnd-6_family-8937

Seqidrnd-6_family-8937#DNA/Merlin
Seqnamernd-6_family-8937
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameSparus aurata
SeqGAGTGCATGTAGTGTGTAAAAATACCTGTTTCTGGGCCATCACTGGTCTGTGGGATACTATAGGTGCAGAGTCATCACAAAACTCGTCTGGGGTTGACTGTCTTCTTTTAGATCTTGAGGATCCTTTTACAAAAAAAGACAACAAGTTAGTTAATTGGCATATGGTCTCAATGGCCACTCAGCCTTCACGATAAGCAATGCCTATTGTGTTGGAAGTTAAATCAGTTTGACATGTAACCCACCTGGTGACGAAGAGCAGAACGATGAGTTTGCCTCTGTCTGTGAGAGATCACTATCCACAGCTTCCACCACTACTTCCTCTGAAAAGCAGGGACAACGAAACCAAATCTGACATGAAGAAAGACATGTACTCAGAAACATATATATATTTGTGTGTGCGGAAGTGCCTAGATCCAACTTTTACCTGGCTTTGGTTCTCTGCATTTTCTTGAAAGCTTGCACCTTGACATGTGACTCAATAATCCATTTCTTTTTAGCAAAGCCTCACAGTTAATGCAATACGTATAGTCATTTGCTTTCAATGCTTTTGCAGCTCGCCGCCTTGGAATCAGTGTTCCTCTACCAGTTTTTAGTACCTCATTGTTATGTGCGCGGTTTCCCTGGTTTCGTATTAATTCAAAATGGAATTTTCTTTCCTTTGANTTCAAAGGAAAACAGGCTGCTTGTTTCACAGCGGTTTCATGGCAGTGTTTTTGTAGCAAGTGTCTCGCCATTTTATAGCAGTGTACAGGACAGTACAGACAATATTGGGGTTTGTTGTAAATTCTGGAACCATCTTTCTTTTTTAGCAGCTTCAATACTGCCACATTTCCCATCTTTGTGTAATCACAGTTTTCACTTTCTGCTCCCCTATTGTCTTCATCTGAAGAAATACTGAAGACTGTCTTCCTTTTAGAGGTCCTCTGTGTCTTCCGTTTCTTCAGCTTTTCCATCTTTGTGTCATCAGTGTTTTCTCCTTCTGCTCTCCTGTTGTCTTTACCTGAAGAAGTACCAGGCCATGTCTTTCTTGGAGAAGTCTTCTGCGACGTCTTCTGTTTTTTCAGTTTTACCACTGGAACATTTCTTGTGAGATCGTAAGAGCCCTCTGAACTGCTTCCACATGGAGAGTTTTTTGGCGGAATATATTCATCATCACTGATTTCAATGGTGCTCATAGAGGATTCTGATCCATCAGACACGTGGGGGTTGGATTCCCGGTACACTTTGGTCATCTGGAAATGAAATGTACAAGACGCTTATAACTACATTATTTGCAAGAAACATCAATGGTAACACTTAATTTAAATTTGGGCTCTTAAGAATAACATGACACTGTCATCAATGTCATTAACATTAATAAATATTAATGATTGTTATTACGTGTCATTCGCTCAATTATGTCACTTTCCCTTTAAAGTTGACATTACCTGGAATGACTTTATTATGACAACGTGACATTAACCATTAGCTATTGTCATAAATTGTCCCTTACATCACTTTCAATTAAAGGTTGATGTTGTTTAGCATGTTATAGTCATGACAAATTTACATTAGACAAGGCAAAATAACATAAGGACATAAGCATGACACAGCAGGCATGATAAAAAATGACTTGTCACTTGATTCTCAGGTTTCTAATGTAACTCACCATTCTGTTATTTAAGCACTTGACAGTGTAATAACATTACATATAAATGACCATTAATAAGTCCAATACTGTTGACAGTTTATTGTTTTCATGTTTGTATATTTTTCATTTCTTAAAAGGCTATATTCTTGTGTGAACCTCAATATTATTATTATTATTTATTTTTATTAGTAAAGACTCTTATTTTTAAGACGGCATACTGGAACCCACGATAACTGGGTTCTTGTGTGGAAAGGAGTTACAAGCTGAAATTTCTGACATTCTGTTTCTGCTTGTTTCACATAAGGACAAAACATCAGTTAATGCAGATTTAATGTTTTGTGTCACTGTGATCAGATATCAGTGGAGCTCAAATTAAAAAAGGGCTGTTTATCATCAATCGCTGAGATTTAAGCACCGCAGTCAAAATGAGTCCAGCTGACTTCTCTGCATTCAGTGCCGGCACATGGAAACAGAAATGAGCCGTTTGTTACCAATACAGCTTATTTTGCTCTCAGATAACTTGAAGACAAGACTTTAACTTTTATAGTTGGTCATGCTGTTGTCCTGAAAACATGTGAAAGAATTCAGGTGTGTTCACACTCAGCTGCAGCTACATGCATGTTAAATACGGTTAGCTTAGCTTAAGCTACTCACCGCTATCTTTACTAACTGTAGGCATCCAAGTCTGAGGATAAGGAGATGAATTACTGAAGACAGAGTAACAAGTCCTGAGTGCTGGCATTACATGTGTGTTTCATTCAATCTGTCAAAAACCTACAAAACAGTTCAATATTGTTTGTTTTTCAAGTGTCGGTTTGCAGCACAGGACAACAGCATGACAACTATAAACTATAAAGTCTTGTTTTTACTGTTATCTGAGAGCAAAATAAGCTGTATTGGTAACAAATGACTCATTTCTATTTCTGTGCTCCTTTGTTGAGTGCAGAGAAGTCAGCTGGACTCATTCTGAACCAGACTGTGGTGCTGAAAGTTTATTAAATGCAATGAAACAGTCTTTTTAAAAATCTTTAGACAAACTCTGCAGCTCCGTTTGCTGCCATGTTGTTGTGTTGGTTTCTCTGTGGAAAGTCAGTGCGGGAGGGCGGAGCCTACTATGAACTATGGGAGCCCATAAGGAGCGGTGGCAGAGCTAGTTAAAAGAGAAATTTGATTTTATTTTTATTTTTTAAATCGTCCTAAACCAGAAACTTGAATTAATTAATTTTACCGATTAATCACCCAGCCCTAGATCCAAACATTTGTTTGTTGAAAAGAAGAAAAATAAAGAAAATCACCAGGATGATCCTTTGTTTATTTTCTGTTGTAAAATCTAAACTAGATTTCATCATGCAAACTTACCAATAAGCTGTCTGTTCCTCCAAGGGGTGGACCATCTGGGTCTTCAGCAGGACCAGAGTGTGAACCTTCAGGAGTTAACATCTCCATGTTGCTCTCAAAGTCTTGAATGTGTACCTCATACGACCACATCTAAAAAGAAAAAGAAAAAAGAAAAAACAGAGCTATCCCTGTCAGAACAGCCTGTGCANATGAGCACATGACTTGTGGAGTAAACGTACATGCTAACAACGCAGCGTNTNTTGGAACAGTGACAGCTTAACTCNCTCTGACACGAACCTGCACATTATNAAAGAGCTAAGGAGCTGCAGGCAATAAAATATGAGGGATAGATACAGTACAAGCNTGTANTTCCANATGCAGTAGACTTTCCTATNGGTACCAATAGCANAGTAAAATGTGAGGGACTGCANACTGGTAGACAGTGTTTTCCACATGTAGCTGTAGGTCTGGTGACAGCCTGCAGCTTGCNCACAACAAGTAATGAATTATTTAGTCCCGAACACCCACATCTCAAACATTCACTGAAGTGATTTCTAATTACCTGGGAGAATACTTGCAACATAACTGGCAAGGCAACAATAACAGGGTGAAGTAAACTATTAGGGGGCTGTCANATGGAACAACCTAAAAGTGCNTGTTTGCCACTTACCAAACTCTTGGAATCTGNAAATGGCTCAGACGGAAGTTCTGGTAGCGATGAGCTCTCCCNCTCNTGGTTTGGTCCTCCTGAGGGCTAAACACCACAGGCAGACACATTCATTANCATTTCTCCAGAATATGAGGTTCACAAAGACCTGAAGGGCCACAGCAGTACACTCCTANTAGCATCTTTTCTTTATCGAAAACTAAAACATAATGTGTAAGAGGCCNCTTTGAAAAGACAGACCAGGGTCTTTGTATAAAATCNGATTTTTGAATGTATGGATGTTGACTCACATTTNAAAATCAGAGCCCCATCATCATTACCTGTGTTTGTTGTTTTTCTCGCTCCATGTGCACTGGATAAGCATTTATCGTGATGCNCCCTCAGGCACTNTAAGCGTGCNTTCAGCCTGGTGAATCNTGCTCTCTGTCTGCAAGAGGTTAAACGCAGCACAGTTATTACCNGTAACATCTGTATACCTAGAAATGCATCACTTTNATACACATAATAGANATATCTATNNTTTGAGGGGTGACCAGCTGCTCTACAGTTAACCTGGTTATGTGTTAGTNAACAGAACATCCANTGTTTCCGCTACATACATTTTGCAGCAGCAGCAGCCAGGTTCCCCCTGCAGANCTCTGATGTGTCTGCATGTGAGCAGATGCAGAACAAAAGACAGACGGCACTGCCTGGAGNGGCAGGATGAGAGAGAGATGATCCCAGGATTTACAATANCTGCAACCAAAGTCCGACTGAAACTTAAACTAACACGAAGCAGCCTGTAGAAGTCTGAATAAGTCGGTTTCCACCGCTGAATATTTNACTGTTTGTTGCATGCAGACACTTNCAGCTCTGAGAGGAAAATCTCCTCCGCTTCTGTGTTGCTGCGCTGCTGCTCGACACAAACACCCGCCACCNGGTAACAGNCAGGTAGGACACCAAAGCTTTTTTTTTTATCGTNAATAATTNNAANAATCATCATTATAAAAACGAGNAATCTGTTAGCGATCTGCAGCATGCACACACGCATTTACAGTGACAGGGTNACTNAGGTGTGGTAAACGCACTNAGANGAACAGNAAGAGTAATTNATTATTTTCTTTGTTAANATNTATANANATGNACTCATATGTTCTAACCACAACTCAGCTNCTGCTTGTTTAGGTGTGAAAAAAGCATTTAACGTTACGCCTGTAGTTCAACGAGGTAATCGTTCGAGCACNTTNTTCANAGCACTGGANGCTAACGCTAACNCTAGCTACTGACGGCTGTAGCACGTTAAAAATGCTCATTATACTTTNCTCTTTCCNCTCACACCCTCAATANTANAGTAACNTTAACGAAGTATCTGAGNTCAACCAAGTAAAANTAACTNAAGTGGCAAAAAGACAAGTCCATGNCTGTNAAAAGCTAGGTCATGTTAGCATTAGCAAACNATCTNAATANAAAANTGAGNGNGCNNTTGGCNGCAAACACGTCAGCAACAANGATTAGTCTNATTANTAATNANTNAAACAGTTTTANGTACTTACTTTTCNTTNATTTCTCCTTCTTCCATCCGTCGCCTCCGTCTGTCTGTGCTGCTGNTTCTGCCGCGGTCAAGTGCTGCTGCTGTGAGAAGCTCCGCCCACTCTTAATTGGGTTCAACTGACGGTCAGCGTTTGAAGCTGCATGAGTGGAATGCGGTGGGGGATGGGCAGGTGGAGGTGGCAGCAGCCAGGTGGCTCAAGCAAAGATATTCTCTCCAAACCTTCTCTGGCAGAGCAGAGGTGGTGGGGTCCGCAAATNTCAGGAAATGTGTTTCCTCCTTCACCTTTGATTCAGTGCAGAGATTTTANCATTGCATTGCTGAACTCATGTTTCACCAAAATAATAGTGCATCCAACAGAAAAATATTTNAAAACTTTCATAAATATATATTACATTTATTTTATTTTATTNTATTAGANTANATATGTANTTNTTACTACTAGTAAATTACTAGTAATAATTCATATNACTCGTACATGAGAACAGAACATGTNTACTTGAACCAATAATTCNAAAGACAGCTGNAGTGNTAGTTGCATTGATGATAANATTAATAACAATATAATAATAATTATAATAATAATATACCTCATTTATAAAGCACCTTTCACAACAAAGTTACAAAGTTCTTCACAATACAAAGAGAAGCTGAAATAATGGAGTAATATGCTGCTGCATTTTGGACAAGCTGCAATGTTTGTAGACTCAGATGTGCAGAGAGAGTTACAGCAGTCAAGTGCTGCTGCTGTGAGAAGCTCCGCCCACTCTTAATTGGGTTCAATTGACAGTCAGTTTGAAGCTGCTTGAGTGGAATGCGGTGGGGGATGGGCAGGAGGCATCGGCCAGGAGGCTCGGGCAAAGATATTCTTTCCAAACCTTCTCTGGCTGACATGCTAGGGTCCACAAATGTCAGGAAATGTGTTTCCTCCTTCATCTTTGATTCAGCACAGAGACTTCATTGCATTGCTGAACTCATGTTTCACCAAAATATTAGTGCATCCAACAGAAACATATTTTAAAACTTTGTATCAATATATATTACATTTCTTTTTTATTTTACCCTACTAGTAGGCTACATGTAAAAAGAACATGTATNCTTGAACNAGTAATTCAAAAGACAGCTGTAGTGGTAGTTGCATTG