rnd-6_family-12066

Seqidrnd-6_family-12066#DNA/Merlin
Seqnamernd-6_family-12066
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameOncorhynchus mykiss
SeqTGTGATACCCACTCTCTATACTAATTCAGTGTAAACAGCATCTGAGAGAGCTGCTCTGGTGTGACCCCTGACCTGGCAGCAGTGATGTAGTGAGAGTAGTGGTAGTGTTCATACCCAGTATGTTGAGGTTGAAGTGTCTGCTGTGGTCCCTGCGCTGTTGTGCTTAATCATTAATGCATATAGTAGTTATTTATACATNTGAGAATACCTAGCTGACTAACATTTAACAAATGTGGAATTAATGATTAATAAATGGTGAGCAAACTGTAAATNCCTNACAAATGGTTTATTACTGAACATTATAAAGTGTTACCCATAATTGCATATTCTTACATTTTACCATCAACTACTTACACAATACACCATTGAGNTAGACTTGGACGTTATCTGATATCATGCAGTATTGTACATTTCAACTTTACTGCACTTGTTGAAGACGTTGTGTCACAATTGAGCCACTAGAGGGAGATGTTAAACAACATATAGAATGACTCATGACGTCCTCAGAATGTACTNTTAGAATACTTACATACTATTTATCATTAAGTAACACGGAACAACCACAGACTTNGGTATTTGGAGTACACAATCCACAATGACTACAATGTNTTTTATAAAACAAGCTTATNCCTTCTTATGCCTTCTCCAAGTCATTCCATTCCAATCCAGCCAAATCATTCTGTATCAACACCACATGTACCTATGATGANAACACTGAGATAAGTNATGTCAGTGTATTGTTACATGAAACAATTACAACAATTGTATAACANAACTATGTCAAACCTATGTTTGTNAAACTAGGGAATAAAATTATAGGAACTATGAACGCCTTAANTTCAGAGTTAAAATANGTTTAGCTGTCACTTTGAACCATGGATAAAAGAAAGCATAAATTATTGGATTAATTAAGGAATTAACAAGTGGCAGAAAACTGATGAAANATGATAANAAATTGTCAATTAAAAAAGATAAAAAAAAGAAAATAAATAGAGATGGAATCCAACAAATGAAATAGTTGAAAACAACAATAGATAGAGTTTTTGCTGCTTTTCTCTCAGACTTATTTGCCTGTACAGTTTTAACACCAGACACACTGGCAGCCTCTTTTGAAAACACCTTTCTGGCCTGTGATCTGGCCACCACAAAGATTTTCATATAAAGTGTTATAATAATAGAGCACGGGACAACCATTGTAATTACAAGGTCAATGATATTAACCCAGGTTANCCCTTCAANAATAAAACATTCTTTCAAACACCTACTNGGTACCTGTACATTTACAAAGTNTTTTATAATAGCAGCACGGTATATGATACAACAACACCAGGTAATGGATATACAACACATCATTCTTGTTGTTGTTATTTTAGAGTGGTACAATAAGGGATCACACACAGCAACATAGCGGTCAATAGATATCAAGACCAAATTGCCCAGAGATAAAGAAGTACATAAAAAAGCAATGTAGANATGAAACACACAGAAATATTCCCCAAAACCCCAGCATGGTTCCATTGTTGCTACAGTCGTTACTGGTATCACAATCAGTCCCACCAGGAGATCTGACACAGCCAGAGAGAGGATGAGCAGGTTGGTTGTAGTGTGGAGCTGCTTGAAGTGAGAGATGGAGATGATCACCAGTACGTTCAAAAATACTGTAACTGCTGAAATCAATGAGAAGAAGATGTACAGTGTTATGTAGATAGATGTCGACAGCAAAGCCTTTCTGCAAGAAGAGTTTCTGTCTTGAAAACAGTATTGAACATCTTCATGTTTCTCCATTTGTANTAAAAAGTAAAAATGCTGAGGTCCTGCTCCTGCTTGGTCCTGTGTGTGACCCTGTCAGGTCCGCCTTCTGACAAACTCTGAGCTCTGCCTCTCTATTTATCCCTGAGCTACTGACAGAAACTCCCCTCCCCGGAGTCTCTCTGCACACACACACACACACACACACACACACACACACACACACACACACACACACNACCACNACCAC