rnd-6_family-2041

Seqidrnd-6_family-2041#DNA/Merlin
Seqnamernd-6_family-2041
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameOncorhynchus mykiss
SeqTTAATGAAATATATCCATAGCATATCTATAGCGCATTCATGTCATGCTATGCAAGAGCTCATATTTAGGTATCTTAATAGATGCATCATTACAATGACAGCGTAGTGTCATCATTATGGCTGTTCTCAAAAGTGTGCTTCTGCCATACCAGTGTTAGTGAATATGCCAAAAGGCCAAACCACGTTTTGAAAATTATGCTGATATATAGCCTGTACCAGCCCCATTTCCCCCACCGGCCGGTATAGGCCCGTGACTTACCTTCTTCTTCTCACTGAGGTCAATGGTGCATGAAGATCCCCACAGGGTTGAATCCTCAGGGTANATTTTACGGATCAAATCGTGTAGTTGAGGGTCATAACTCTTTCGTAACTCATTAACAGCCCTCCTCCACATCACAATTAAGTTGGTCATACTGGTCTATAACGCACACATGAAGGGTCTATGTATGAATTCTATGCAGTCAAAGTAAAGTCANATCTATTTTCCCATTCATAAAGCTTTATAGCTAAGCACTTCATGGTAATTAGCTGTGCAGTTTGCCACTGATCTATAACACCAACATTAAANGTCTATGTATGAATTCTATGCAGTCAATGTACTGTCATTTCTATTTTCCCATTAAAGCATTCATAAAGCATTTATAAACATGCCTCACTTATCAAAAAGAATACAGACACAACACAGAATATGAACATTTTATTTNCATTTTCCAGATGTAGCACAGAAAACAATTGCTGAGGGCATCGCCGAAGAATCCTACTATTGACATTTTTCAGTTGGACTTTTCTTGAATAGATTTAACAAAGATTCATNTTCAAAGCATTCAAATTAAATTCCCCATTTCAGACTCATAGCAATAACTATTTTAGTGAGTAAAACGTACTAACACAGGGTGGTAAAGCTAGCTAGCATTTCCCCCTTATTCACTAATGTAGCTAAGCCCCTGGCAATGTCAACACGTTTTCCAACTCGTCGATAAACGTTCAAAGTACTCATAAAACATTTAGTTAACAATGTTATCTCACTATTTTAAGACGATTGTACTTTNGCACATTACGAACCTTTTAAAACAGGACAAATTAAGAGACAGAAACCAGTTGCTTTCTTTTTGGCTGCAGAGGAGAGGTGAGAGGTCAGTGTAACGTCACTTCCTGGTGAC