rnd-6_family-1372

Seqidrnd-6_family-1372#DNA/Merlin
Seqnamernd-6_family-1372
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameOncorhynchus mykiss
SeqAATCTCTCGTGGACAGATTCTGCGTGTAGACCGAAGAATCTGTCAGGACTGAATGGAATGATGTGATNACGAGCAGCAGTAGTTCCTGGTTTGGGGTTTTCGTCACTGATTATTTGGACGNATCAGGATTGGGCGAAGGCGGTGCTTAAACTGGTGCGGTGATTTTCAAGCCCGTGTGCGGATGATAAACGGTTTCCACTAGATTCCACAGCCACAAAGTCAAAATTGGCTATATTGTAAAAATGCATGAAAACAAANATGTGCTTTTCGGCCATGATAAACACGGGTGAAATTAGCGGAAGGGAGGGGTTTGGCCGAGAGTTTCCNTTTGCGAGGGNGGAGACTTCGCTTCCTTCCTTTGCACAAAGGTAATCACAATTGTTAACGGCATTCCCCCCAGAAGTAAAACAGGAAATGACAAACTTTCGCGAGAATTTTACTTCTGGGTAACCGAG