rnd-5_family-2510

Seqidrnd-5_family-2510#DNA/Merlin
Seqnamernd-5_family-2510
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameOncorhynchus mykiss
SeqTAACACTTTATTTGGATAGTCCATCTGTAGATGCTCTACAGACTATCAGTAACATTTCAACTAACTATCTACTAACCCTAACCCTAACCCTNACCCTAACCCTAACTCTACCTNACCCTAACCCTAACCCTTACCCTAACCCTAACCCTAACCTTACCCTAACCCTAACCCTTANCCTAACCGTAACCTTAGCAAGCAGTTGCTTATCAACAGATAGTTTGTTGATAGTATGACCATCTGTAGAGCATCTACAGATGGAAATCCGGACTATCCAAATAAAGT