rnd-6_family-1204

Seqidrnd-6_family-1204#DNA/Merlin
Seqnamernd-6_family-1204
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameAmia calva
SeqAGCAGGCCCAGACGGAATCTGCGGAAGTTTAGTCTAAATTCTGCGGAACTTTTTCTGTAAATTCTGCGGAAAATCTGCATTAATTAATTTTATATTGTTTTATGCAACAACAACACAAAATAAATACTTGAATTATTATTTTTACTTTATTACACCTCAGTAACATAACCAATATGTACATCCATTAGATTGAAGCCTTAAATTACGATACAAGCCAACTACATGTGTTTAAACAATGAAAATATTTTACCAGCTATAAGGTAACACTCAAATATTTACATTTTGCTTTTGAGAATAAGAAACAGAGCTATTTGATCTAAACAGATGTACACAAAAACTCAGCCAGTATCCCCTTTACAGCAGGGATGCTAAATCCAATCCATTAGGGTAGTTTTGTTCCTATCATGGTCATCTT