rnd-6_family-580

Seqidrnd-6_family-580#DNA/Merlin
Seqnamernd-6_family-580
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameAmia calva
SeqGGTAACACTTTACAATAAGTACCCCTTATCAGACATTAACTAATATGTTAGTTAACATGAACAAGCCAGTAACTAATGCATCAACAAGTCATGAAAAGTAATTTGTTAATGGTAACTAATTAACTACTGCATGAATTAATGTATTGGTTTGTCTTTCTTCATGTCTGAATATTCGGAGGCAGTAACTAACGCGAACAAATNACTTAGTTAACATGAATAAACATTACTCATTTCAAGGACGACATATTTAGATGTTTGTTAATCCTAAGAGTTGTCAAAATAGTCACCAGATTTTCCACGACGAATGTAATGATCTTATGAAATAACATTAAATACCTTTGTTAACATAAAGGAAAATATTGATATATTTACTAAACATGATCAGTGCTTATTCATGTTAACTAATTCATCAGCAAATGGTTTATTAGATGTTTTCTGGGACCTTTGTGCATCATGGTTAATGAGATCATTATTCATTTGTGGGGCAATGACTTAGCCCAAATATTTAACAGGAATTATTATATTCTCACAACAAAGTAGTAGTAGTAAGTGTTGAGATGAATGAACAGGGCTTTAATGGATGTATGACTTACTTGCTGAACTCCATGCTGCCATCTTCCTCTGCAAAACAGGTTGAGAAGGGTGGGTACCATCCGGGGACATCTGTGTGTGTGGTGTGCTTTACATTTATGATTTATGCCTTATTAATGGCTTAAGAGTTATCACACATTACGTAAGCTAATTAGTGAATTAGTTAACCCTTTTGGAAGTGCCTGATGTAGTGGAAACTGTTCATGACTTACCAATGCATTACTAGTGCTCCTTATGCATTAGTTAACATTAATAGGGTCTTGTTAACACATTTTGGTGTACCTGTGGTAAAGTGGAAACTGTCCATTCCAAAACAATGGTTTGCAAATGCTTATTAGGCATGTTTTTAATGTTTTAATTTATATTTAATTTATTTAACTATACTGGTATAAATAACGCAACCCAGTCTCACGAGAGAAACGTCAACAGGCTAACGTTTAGGCACTGCGCTGTTTTCTGCTGGAAACACGTCACCTGGACCCTGGGAGAAGGAATAAATGCGCCAATAGAAAGCTACATAAACCTACCNAACACAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAACATCATATTTGCCGATCGTACTGCATGGCATAATCTTGCATTTGAATATGATT