rnd-5_family-3681

Seqidrnd-5_family-3681#DNA/Merlin
Seqnamernd-5_family-3681
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameAmia calva
SeqCATCCCTCCTCTTCTAAATCCCCTCATATATGGCTTTAATCTGAGTCAGATTCGCAAGAGAGTTGTGAAATCGTTTAATAGAAAACTAGATGCATGCAGTCTGTGACACCAAATATTGGTAACACTTTATAATAAGGTGCTGCTTATTAATGTGTTATTAATTATTTATAAATGTTTAATAGATGATTAATAGATACTTTATAAAGCATTAATAATGCATTATAAATTAGTTATAACTCGGTTATAGCAATACATGGAATGGCCACAGTCGAACAGGTAGCTAAAAAGTGTCCCTCTTATAAATAAATCATAATCAAAAAGTGTAAAAAATATTTATTAGGAATGTGTCAAAGCAGTAGTGAAAAGGGACACTTTTAGCTACCTGTTCGACTTTGTGACCATTCCATGNATTGCTATAACTGAGTTATAACTAATTTATAATGCATTATTAATGCTTTATAAAGTATATATTAATAATCTANTAAACATTTATAAATAATTAATAACACATTAATAAGCAGCACCTTATTATAAAGTGTTACCAACTGAATGTATAGTGCACGTATTTTGGGATGTCATAAATAAT