rnd-6_family-102

Seqidrnd-6_family-102#DNA/Merlin
Seqnamernd-6_family-102
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameGambusia affinis
SeqGTAACACTTTATTTGAAGGGGTGTGCATAAGACTGACATGACACTGTCATAAACATGACATAACACCTGTCATGAACATGAAGAAGTCTTCATGAATGTTTATGACTGTTGTCATAAAGTGTCATTCGGTAAATNATGACACTTTTAATGCAAAGTTGCACTAAAACTTGCATTAAAAGTGCATTAAAAGCAACTTTGCATTAAAAGTGTCATTATTTACCGAACAGTCATAAACATTCATGAAAACTCATTCATGTTCATGACAGGTGTTATGTCATGTTTATGACAGTGTCATGTCAGTCTTATTCACAACCCGTCAAATAAAGTGTTACCGAAATNAGTGTTATTTTTAACAATATTACACAATTTCTCA