rnd-6_family-3810

Seqidrnd-6_family-3810#DNA/Merlin
Seqnamernd-6_family-3810
Seq TypeDNA/Merlin
ClassCLASS II
OrderTIR
Super FamilyMerlin
Species Latin NameGambusia affinis
SeqACAGGTGTGGAGGGTGCTAATGAGGACCAGCCACGAGAGAAAGAAGTCCCTGTTTGACCAAAGAGAAAGAAGCAGATGAAATATTCCCCAAGAAAATTAGGTAAGTCATTTTTGTGTTACTATTTTCTCCAGGTGAAGGGGGGTGGGGGGACAGGTAAGTGGGGAAGGGGGAGCAGGAATCAACATCCACCAGTTNAGTTAACAAGTTACGTTTTAGACAGCTGATTGTTGTNAAATGTAAAACTGGTGTTTAATCTACTTATTATTTATTAATAAACTTCTTAAGCCATAAGCCAGAGTATCTGGTTGGAAATAATTTTGAATGCTCATTAAGTGAAAAGATACACTCATGTGCCTAAAACTATACATTAAATGATGCATTCTGAATAACAACAGGTTGTATGAACTTCTGCCAAACAAATATTTGATCAGAATAATTTTGTTCAGCTCTAGTCATTATGCTACTTGTATTAAGAAATAATTGTATTGCACTTTATAACAACCAGTCACGTTAACTAGACATTTGTCTGCCAGTCTACCATTCTGACAGTGTGCAGCAAGGGACATTCTTGGAATGGTATTTAAATAAATGCTGAATTAAGATCACGTTACATTTTTTGTTTATTTGTTTTTGTTCCTTTTTTNAAGTGACCTCAGTGGATTGAGTCATCACCCACTATGAGAATGTCCAGAAGAGATTCACCAAGTTTGAATTCATGAAAAGGCTTTCACCATGATTAACCATTGCAAGAACAGCTATAATTTCTGAGCATTTCCGGACACCTTCAAAGAGCTGNTTCCAGGAAATGAAGACAAGAAGAAGATCTCCCTGTTTTCAGAGCGTTACAGGAAGGCTATAACGAAGGAGATGGCTGACNCAATCGAAGCAAAACATGTTAGGACTGTTTAAAGAACCTATTTTCTTAAGTTAAAGAATAAGTAATTCTGTTTTAGTTTTTCAATTAGTATTTCAGAGTTACAATATACTGACCAGAAGTTAAACCCTCTGTGAAGAACAAGTAATCCTTTGTTTTATTCCAATGTACAAAGGGTTTGTTCTACAGCTATGATGGTAGTTATAAGTTGTCCAGTGTTTTCCACTTCACTTGAGGTAAGACTTAATATTAATGACTGTGTTAACATAGCATTTGACACTGTAATAACACTTAATGACATCTTTATAACTGGTCCTACTTGTTTCGCTTTACTTGAGGTAAGAGTTAATATTAATGACACTGTAATAACACTTAATGACATCTTCATAACTGGTGCTACTTGTTCCACTTTATGTAAGAGGAATTATTAATGACTGTTATTAAATCATTTGACAGTGTAATAAAGCTTAATGAAATCTTTATTGTTGGTCCTACTTGTTCCGCTTTATTTCAGGTAGGGGGAAATATTT